View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16052_low_27 (Length: 226)
Name: NF16052_low_27
Description: NF16052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16052_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 51416778 - 51416586
Alignment:
| Q |
16 |
aatatgattcacctgcgacatgcacatgatgtgctatctcactcaatcagcattaacaatgatgatgatccaaccatctctgtgaactcctctgccgcct |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51416778 |
aatatgattcacctgctacatgcacatgatgtgctatctcactcaatcagcattaacaatgatgatgatccaaccatctctgtgaactcctctgccgcct |
51416679 |
T |
|
| Q |
116 |
ggtcaacatgaaactctttctgctcctccgccctctccctcgtcatctttacgcgcctccattcatttctggttccacgacataccctcattt |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51416678 |
ggtcaacatgaaagtctttctgctcctccgccctctccctcgtcatctttacgcgcctccattcatttctggttccacgacataccctcattt |
51416586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 136
Target Start/End: Complemental strand, 51413666 - 51413628
Alignment:
| Q |
98 |
tgaactcctctgccgcctggtcaacatgaaactctttct |
136 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
51413666 |
tgaactcttccgccgcctggtcaacatgaaactctttct |
51413628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 155 - 192
Target Start/End: Complemental strand, 51418659 - 51418622
Alignment:
| Q |
155 |
tcgtcatctttacgcgcctccattcatttctggttcca |
192 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
51418659 |
tcgtcatcttcacgcgcctcccttcatttctggttcca |
51418622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University