View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16053_low_13 (Length: 240)
Name: NF16053_low_13
Description: NF16053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16053_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 27489144 - 27488930
Alignment:
| Q |
1 |
tccattaagcgaaatattcatttcttgacgtttgatgcaatttatttggtatagattctcacattcaaaatatccctcttaactaattttcttacttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27489144 |
tccattaagcgaaatattcatttcttgacgtttgatgcaatttatttggtatagattctcacattcaaaatatccctcttaact---tttcttacttttc |
27489048 |
T |
|
| Q |
101 |
accattttccatccctgtaacacattttgtttattgtgcatacgaggaaggagatggatgagagaattcaaacttttctaagccctgtctttgcctataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27489047 |
accattttccatccctgtaacacattttgtttattgtgcatacgaggaaggagatggatgagagaattcaaacttttctaagccctgtctttgcctataa |
27488948 |
T |
|
| Q |
201 |
aaatgattattttttaag |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27488947 |
aaatgattattttttaag |
27488930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University