View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16054_high_26 (Length: 298)

Name: NF16054_high_26
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16054_high_26
NF16054_high_26
[»] chr4 (2 HSPs)
chr4 (76-185)||(23239319-23239428)
chr4 (181-286)||(23240074-23240179)
[»] chr7 (2 HSPs)
chr7 (185-286)||(44146027-44146128)
chr7 (207-286)||(25803829-25803908)
[»] chr2 (1 HSPs)
chr2 (207-286)||(5750067-5750146)
[»] chr1 (1 HSPs)
chr1 (189-272)||(32654240-32654321)


Alignment Details
Target: chr4 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 76 - 185
Target Start/End: Original strand, 23239319 - 23239428
Alignment:
76 tgatgaatgcatcacctagattatgatgtgagtcctgtagatgttgttgatgagcttggaatcgtacgtcaagaaaatgcacttgccgcattccatctag 175  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23239319 tgatcaatgcatcacctagattatgatgtgagtcctgtagatgttgttgatgagcttggaatcgtacgtcaagaaaatgcacttgccgcattccatctag 23239418  T
176 attgtaacaa 185  Q
    ||||||||||    
23239419 attgtaacaa 23239428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 181 - 286
Target Start/End: Original strand, 23240074 - 23240179
Alignment:
181 aacaatgattgtatttcatattaatcaacatcacatcttttagggtattgatgctgctcgggtggagaaaattcttgacatggcttttataactctcaac 280  Q
    ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23240074 aacaatgattgtaattcatattaatcaacatcgcatcttttagggtattgatgctgctcgggtggagaaaattcttgacatggcttttataactctcaac 23240173  T
281 aagaat 286  Q
    ||||||    
23240174 aagaat 23240179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 185 - 286
Target Start/End: Complemental strand, 44146128 - 44146027
Alignment:
185 atgattgtatttcatattaatcaacatcacatcttttagggtattgatgctgctcgggtggagaaaattcttgacatggcttttataactctcaacaaga 284  Q
    |||| |||||||||||||||||||||||| ||  ||||||||||||||| |||||||| |||||||||||||| |||||||| |||||| ||||||||||    
44146128 atgactgtatttcatattaatcaacatcatattctttagggtattgatggtgctcggggggagaaaattcttggcatggcttctataaccctcaacaaga 44146029  T
285 at 286  Q
    ||    
44146028 at 44146027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 207 - 286
Target Start/End: Complemental strand, 25803908 - 25803829
Alignment:
207 aacatcacatcttttagggtattgatgctgctcgggtggagaaaattcttgacatggcttttataactctcaacaagaat 286  Q
    |||||||| || ||||||||||||||| |||||| |||||||||||||||||||||||||| ||||| ||||||||||||    
25803908 aacatcacgtcctttagggtattgatggtgctcgagtggagaaaattcttgacatggctttgataaccctcaacaagaat 25803829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 207 - 286
Target Start/End: Complemental strand, 5750146 - 5750067
Alignment:
207 aacatcacatcttttagggtattgatgctgctcgggtggagaaaattcttgacatggcttttataactctcaacaagaat 286  Q
    |||||||| ||  |||||||||||||| |||||| ||||||||||||||||||||||||| |||||| ||||||||||||    
5750146 aacatcacgtcccttagggtattgatggtgctcgtgtggagaaaattcttgacatggcttctataaccctcaacaagaat 5750067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 272
Target Start/End: Original strand, 32654240 - 32654321
Alignment:
189 ttgtatttcatattaatcaacatcacatcttttagggtattgatgctgctcgggtggagaaaattcttgacatggcttttataa 272  Q
    ||||||||||||||| ||||  ||||||| || |||||||||||| |||||  ||| ||||||||||  |||||||||||||||    
32654240 ttgtatttcatattagtcaa--tcacatccttcagggtattgatggtgctctcgtgaagaaaattctcaacatggcttttataa 32654321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University