View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16054_high_30 (Length: 258)
Name: NF16054_high_30
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16054_high_30 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 6013691 - 6013933
Alignment:
| Q |
16 |
aaaatgtcagtggttagattaaaacctctatccggattcgatcataaaaaattctctccaaactagtagtctttgttaaaccccgttggttgttaaaatt |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6013691 |
aaaatgtcactggttagattaaaacctctatccgaattcgatcagaaaaaattatctccaaactagtagtctttgttaaaccccgttggttgttaaaatt |
6013790 |
T |
|
| Q |
116 |
ttgggtttatttgttgattccttagtttggttccttaaacttaaaccttattttttgaggtaattcaatttcctcagttgcctgccacttcgtgtgttct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6013791 |
ttgggtttatttgttgattccttagtttggttccttaaacttaaaccttattttttgaggtaattcaatttcctctgttgcctgccacttcgtgtgttct |
6013890 |
T |
|
| Q |
216 |
gaaacagagcagctgacacaaatgaacgtatcttcaaaacttt |
258 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6013891 |
gaaacagagcaactgacacaaatgaacgtatcttcaaaacttt |
6013933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University