View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16054_high_34 (Length: 253)
Name: NF16054_high_34
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16054_high_34 |
 | |
|
| [»] scaffold1787 (1 HSPs) |
| | |
|
| [»] scaffold0060 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 112 - 208
Target Start/End: Original strand, 21205635 - 21205732
Alignment:
| Q |
112 |
aaattcagcaataaaagagtgaaccttaatgtcaa-ggtatgcatcggaaatgggaagatggttattgttgcatttatgattggtaaaggttaagaac |
208 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
21205635 |
aaatgcagcaatgaaatggtgaaccttaatgtcaaaggtatgcatcggaaaagggaagttggttattgttgcatttgtgattgataaaggttaagaac |
21205732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 15 - 82
Target Start/End: Original strand, 21117529 - 21117597
Alignment:
| Q |
15 |
ggatccactcaaaaattaattattgaatcaagtacttttt-gggtacaaagtatacaaccaaatatatg |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21117529 |
ggatccactcaaaaattaattattgaatctagtactttttggggtacaaagtatacaaccaaatatatg |
21117597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 116 - 237
Target Start/End: Original strand, 21305699 - 21305822
Alignment:
| Q |
116 |
tcagcaataaaagagtgaaccttaatgtc-aaggtatgcatcggaaatgggaagatggttattgttgcatttatga-ttggtaaaggttaagaacatata |
213 |
Q |
| |
|
|||| |||||||| ||||||||||||||| ||||| |||||| ||||||||||| |||| ||||||||||| ||| ||| |||||||| |||| ||| | |
|
|
| T |
21305699 |
tcagaaataaaagggtgaaccttaatgtctaaggtgtgcatcagaaatgggaagttggtacttgttgcatttgtgatttgttaaaggtttagaaaataca |
21305798 |
T |
|
| Q |
214 |
gcacaatgaacaaaaagttggtag |
237 |
Q |
| |
|
| ||||||| ||||||||||||| |
|
|
| T |
21305799 |
gtacaatgaggaaaaagttggtag |
21305822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 190 - 237
Target Start/End: Original strand, 21212918 - 21212965
Alignment:
| Q |
190 |
attggtaaaggttaagaacatatagcacaatgaacaaaaagttggtag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21212918 |
attggtaaaggttaagaacatatagcacaatgaggaaaaagttggtag |
21212965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 237
Target Start/End: Complemental strand, 21244379 - 21244335
Alignment:
| Q |
193 |
ggtaaaggttaagaacatatagcacaatgaacaaaaagttggtag |
237 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
21244379 |
ggtaaaggttaagaacatgtagcacaatgaggataaagttggtag |
21244335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 109 - 237
Target Start/End: Complemental strand, 1338 - 1207
Alignment:
| Q |
109 |
cacaaattcagcaataaaagagtgaaccttaatgtc-aaggtatgcatcggaaatgggaagatggttattgttgcatttatgattggtaaaggttaagaa |
207 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||| ||| | |||||| ||||||||||| ||||||||||||||||| |||||| || |||||||| |
|
|
| T |
1338 |
cacaaatgcggcaataaaagggtgaaccttaatgtccaagctgtgcatcagaaatgggaagttggttattgttgcatttgtgattgacaattgttaagaa |
1239 |
T |
|
| Q |
208 |
ca--tatagcacaatgaacaaaaagttggtag |
237 |
Q |
| |
|
|| ||||||| | |||| ||||||||||||| |
|
|
| T |
1238 |
catatatagcaaactgaagaaaaagttggtag |
1207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 237
Target Start/End: Complemental strand, 23260 - 23200
Alignment:
| Q |
176 |
ttgttgcatttatgattggtaaaggttaagaacatatagcacaatgaacaaaaagttggtag |
237 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
23260 |
ttgttgcatttgtgattggtaaaggttaggaacatatagcac-atgacgaaaaagttggtag |
23200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 77
Target Start/End: Complemental strand, 21659051 - 21658993
Alignment:
| Q |
21 |
actcaaaaattaattattgaatcaagtact--ttttgggtacaaagtatacaaccaaat |
77 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
21659051 |
actcaataattaattattgaatcaagtactttttttaggtacaaagtatacaatcaaat |
21658993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University