View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16054_low_26 (Length: 320)
Name: NF16054_low_26
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16054_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 303
Target Start/End: Complemental strand, 9050028 - 9049741
Alignment:
| Q |
11 |
cagagaataaccaaatcgtttgtgataccttaaggatcgatctaactattgatcttggaacttatcttggggccctgatgatccatcaatgcattactaa |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9050028 |
cagagaataaccaaatcgtttgcgataccttagggatcgatc-aactattgatcttggaacttatcttggggccctgatgatccatcaatgcattaccaa |
9049930 |
T |
|
| Q |
111 |
gaaacttagagataaaattacttagaataccttttcttttctgatagataaaacgagtaagaaactatcttcttgttggtagcgaattccctctcnnnnn |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
9049929 |
gaaacttagagataaaattacttagaataccttttcttttctgatagataaaacgagtaagaaacta---tcttgttggtagcgaattcgctctc-tttt |
9049834 |
T |
|
| Q |
211 |
nngctcgtcgagaaatcttaaggcaatctttcttttttgtggaaaggcaatcttccctctcatgcatccatttgtgagaagattgaacagatt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9049833 |
ttgctcgtcgagaaatcttaaggcaatctttcttttttgaggaaaggaaatattccctctcatgcatccatttgtgaggagattgaacagatt |
9049741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University