View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16054_low_32 (Length: 288)
Name: NF16054_low_32
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16054_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 50748907 - 50749167
Alignment:
| Q |
18 |
aagattttattgataatggaagtggtctctaagcttttgcnnnnnnngtgttcatattttgttgtgatcaaagtcaatagttataaacgtttggcacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50748907 |
aagattttattgataatggaagtggtctctaagcttttgctttttt-gtgttcatattttgttgtgatcaaagtcaatagttataaacgtttggcacaaa |
50749005 |
T |
|
| Q |
118 |
agctaggaaataaaatgagtggttggaggggatatatttctttcacatgagtgtctttatctttacttttccatccttatacgcttaattaggttatgct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50749006 |
agctaggaaataaaatgagtggttggaggggatatatttctttcacatgagtgtctttatctttacttttccatccttatacgcttaattaggttatgct |
50749105 |
T |
|
| Q |
218 |
gtgtgcttttatcctaaggcatcattttaaagaggttgaaactgctccgaaagttcctttgc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50749106 |
gtgtgcttttatcctaaggcatcattttaaagaggttgaaactgctccgaaagttcctttgc |
50749167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University