View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16054_low_44 (Length: 238)
Name: NF16054_low_44
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16054_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 38184962 - 38184853
Alignment:
| Q |
8 |
atgaagacagccacaaggttttgctatgtcccattttatgtgaaatcttggaaagccattgtttgcaccttttgtggagctactcttcgttcttaccatg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38184962 |
atgaagacagccacaaggttttgctatgtcccattttatgtgaaatcttggaaagccatcgtttgtaccttttgtggagctactcttcgttcttaccatg |
38184863 |
T |
 |
| Q |
108 |
actaagatac |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
38184862 |
actaagatac |
38184853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 38184794 - 38184749
Alignment:
| Q |
179 |
ataagtgtagtagctactggctacttgctgctttttaatttgtact |
224 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38184794 |
ataagtgtggtagctactagctacttgctgctttttaatttgtact |
38184749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University