View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16054_low_54 (Length: 216)
Name: NF16054_low_54
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16054_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 138 - 201
Target Start/End: Original strand, 25690398 - 25690461
Alignment:
| Q |
138 |
ccatctctagctttctctttctttgtcacatatcttggcaaagctccatcagatagtatatagt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25690398 |
ccatctctagctttctctttctttgtcacatatcttggcaaagctccatcagatagtatatagt |
25690461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 85
Target Start/End: Original strand, 25690294 - 25690345
Alignment:
| Q |
34 |
actatctttaaattatctacatttcttgaaagttaacctaaaattctgcacc |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25690294 |
actatctttaaattatctacatttcttgaaagataacctaaaattctgcacc |
25690345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University