View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16054_low_8 (Length: 509)
Name: NF16054_low_8
Description: NF16054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16054_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 263 - 496
Target Start/End: Original strand, 36675739 - 36675972
Alignment:
| Q |
263 |
cttaacactgagagagtaaagaacaatttcaccagtagtagtaacatttaaatgcaagattgtgagacgcatgttttgcaaaccagatacaattttcaag |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675739 |
cttaacactgagagagtaaagaacaatttcaccaatagtagtaacatttaaatgcaagattgtgagacgcatgttttgcaaaccagatacaattttcaag |
36675838 |
T |
 |
| Q |
363 |
agctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaatgcaagattgaatctcaccaactt |
462 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36675839 |
agctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaatgcaagattgaatctcaccaactt |
36675938 |
T |
 |
| Q |
463 |
tttcaccaatagtagctacagaattagaattatc |
496 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36675939 |
tttcaccaatagtagctacagaattagaattatc |
36675972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 25 - 154
Target Start/End: Original strand, 36675498 - 36675627
Alignment:
| Q |
25 |
tttaatttataaggttaaaaaactaatgaatcttaattcaacattgcctcttgttgaatcctagtgaccatctggtatacagctgaagctatatcatcca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36675498 |
tttaatttataaggttaaaaaactaatgaatcttaattcaacattgcctcttgttgaatcctagtgaccgtctggtatacagctgaagctatatcatcca |
36675597 |
T |
 |
| Q |
125 |
ctgatcccaacttgcaatcatcttcaacct |
154 |
Q |
| |
|
| |||||||||||||||||||||||||||| |
|
|
| T |
36675598 |
ccgatcccaacttgcaatcatcttcaacct |
36675627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 46922649 - 46922592
Alignment:
| Q |
97 |
tggtatacagctgaagctatatcatccactgatcccaacttgcaatcatcttcaacct |
154 |
Q |
| |
|
||||||| ||||| |||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
46922649 |
tggtatatagctgcagctatctcatccactgatccaagcttgcaatcatcttcaacct |
46922592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 439
Target Start/End: Complemental strand, 46922372 - 46922272
Alignment:
| Q |
339 |
tgcaaaccagatacaattttcaagagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaa |
438 |
Q |
| |
|
||||||| ||| || || ||||||||||| ||||| || || ||| ||||||||| |||||||||||| |||| |||||||| ||||| || ||||||| |
|
|
| T |
46922372 |
tgcaaactagaaaccatcttcaagagctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtaacttcaatatcagcaa |
46922273 |
T |
 |
| Q |
439 |
t |
439 |
Q |
| |
|
| |
|
|
| T |
46922272 |
t |
46922272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University