View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16055_high_14 (Length: 258)
Name: NF16055_high_14
Description: NF16055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16055_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 49256502 - 49256748
Alignment:
| Q |
1 |
tggtggattatgtcacagatatggctc-----ataagtctatctgttatagtagatagtttacatggtaccctttcaggttggctctttatttcttttta |
95 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49256502 |
tggtggattatgtcacagatatggctcctctaataagtctatctgttatagtagatagtttacatggtaccctttcaggttggctctttatttctttttt |
49256601 |
T |
 |
| Q |
96 |
ctataattcaatgcacaataattcannnnnnncatgaaattcatggtacctgaatgaattatgacatggaatgtaacacttgtctattataggtattgct |
195 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49256602 |
ctataattcaatgcacaataattcatttttttcatgaaattcatggtacctgaatgaattatgacatggaatgtaacacctgtctattataggtattgct |
49256701 |
T |
 |
| Q |
196 |
agaggatgtggttggcagaagttgggagcatatgtgaaccttggagc |
242 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49256702 |
agaggatgtggttggcagaaattgggagcatatgtgaaccttggagc |
49256748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 146 - 242
Target Start/End: Original strand, 49269602 - 49269708
Alignment:
| Q |
146 |
tgaatgaattatgacatggaatgtaacacttgtctattata----------ggtattgctagaggatgtggttggcagaagttgggagcatatgtgaacc |
235 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49269602 |
tgaatgaattatgctatggaatgtaacacttgtccattatatttatatacaggtattgctagaggatctggttggcagaagttgggagcatatgtgaacc |
49269701 |
T |
 |
| Q |
236 |
ttggagc |
242 |
Q |
| |
|
||||||| |
|
|
| T |
49269702 |
ttggagc |
49269708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 39 - 80
Target Start/End: Original strand, 49269503 - 49269544
Alignment:
| Q |
39 |
tgttatagtagatagtttacatggtaccctttcaggttggct |
80 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
49269503 |
tgttatagtggatagtttacatggcaccctttcaggttggct |
49269544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 215
Target Start/End: Complemental strand, 30379883 - 30379851
Alignment:
| Q |
183 |
tataggtattgctagaggatgtggttggcagaa |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
30379883 |
tataggtattgcaagaggatgtggttggcagaa |
30379851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University