View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16055_high_16 (Length: 233)
Name: NF16055_high_16
Description: NF16055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16055_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 44 - 220
Target Start/End: Original strand, 705324 - 705500
Alignment:
| Q |
44 |
gctccttcaacgtacccttgaaatctaactcagtggtctccatggatgcaacaaggtaagttgggcattgaatagcacataggtgccctgcaaaaaagac |
143 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
705324 |
gctccttcaacgtactcttgaaatctaactcagtggtctccatggatgcaacaaggtaagttgggcattgaatagcacataggtgccctgcaaaaaagac |
705423 |
T |
 |
| Q |
144 |
tcaatgcacttaccaatatatcttgtctgcttaaattgcataaacttaaatttaaaactaaaacacaagaagtaaat |
220 |
Q |
| |
|
|| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
705424 |
tcgatgcacttaccaatatattttgtctgcttaaattgcataaacttaaatttaaaactaaaacacaagaagtaaat |
705500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University