View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16055_high_7 (Length: 395)
Name: NF16055_high_7
Description: NF16055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16055_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 8e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 230 - 369
Target Start/End: Original strand, 26452834 - 26452973
Alignment:
| Q |
230 |
tcaaagaaaaagtctgctatcattcgatgcaatgcagtaagcatatatcacacaagtcaactgtctccatgtgtgttttttcaagaaaaaatctgctaaa |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26452834 |
tcaaagaaaaagtctgctatcattcgatgcaatgcagtaagcatatatcacacaaatcaactgtctccatgtgtgttttttcaagaaaaaatctgctaaa |
26452933 |
T |
|
| Q |
330 |
ttttgatgcaagttcactaatatttactctctccaatcct |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26452934 |
ttttgatgcaagttcactaatatttactctctccaatcct |
26452973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 63 - 133
Target Start/End: Original strand, 26452752 - 26452822
Alignment:
| Q |
63 |
taatctcaacttgtgatttggaattcccgaagtaataattgaattatatagatcgcggaccttgctttgca |
133 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26452752 |
taatctcaacttgtgatttggaattccggaagtaataattgaattatatagatcgcggaccttgctttgca |
26452822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 366 - 395
Target Start/End: Original strand, 26453245 - 26453274
Alignment:
| Q |
366 |
tcctcatcgaagaaaatattgagacttctt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26453245 |
tcctcatcgaagaaaatattgagacttctt |
26453274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University