View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16055_low_12 (Length: 295)
Name: NF16055_low_12
Description: NF16055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16055_low_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 214 - 295
Target Start/End: Original strand, 47957038 - 47957119
Alignment:
| Q |
214 |
gcaaaagttatatcaatatggtaacgtttttgtattgaaattgcccctcattttacaagaagtgtacaaatacggttgtttt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47957038 |
gcaaaagttatatcaatatggtaacgtttttgtattgaaattgcccctcattttacaagaagtgtacaaatacggttgtttt |
47957119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 47956825 - 47956907
Alignment:
| Q |
1 |
gaaatatcctacccagtacccacgacccccaccttcttgtctgggtctaaagtttgtctgccccttttgcaacaacaattgaa |
83 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
47956825 |
gaaatatcctacacagtacccacgacccccaccttcttgtctaggtctaaagtttgtccgtcccttttgaaacaacaattgaa |
47956907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University