View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16055_low_14 (Length: 278)
Name: NF16055_low_14
Description: NF16055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16055_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 266
Target Start/End: Complemental strand, 705264 - 705000
Alignment:
| Q |
4 |
gtgtaatggcttacaatttaacgtgtgt--ctgattttcagtttgcaacacataaaaacacctggatgtttagattgatgggacggaatttaaggtcagg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
705264 |
gtgtaatggcttacaatttaacgtgtgtgtctggttttcagtttgtaacacataaaaatacctggatgtttagattgatggggcggaatttaaggtcagg |
705165 |
T |
|
| Q |
102 |
tttagcaggttatatgatttatcgttgtttagggggatgtcagtgtttgatatggatgacagatagctttgatcgttggaatcatctaatgttttcaccg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
705164 |
tttagcaggttatatgatttatcgttgtttagggggatgtcagtgtttgatatggatgagagatggctttgatcgttggaatcatctaatgttttcaccg |
705065 |
T |
|
| Q |
202 |
ttcgtagtgcttataaatttctctcttttcaacctccgttggaatctccggtggctgtttcatct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
705064 |
ttcgtagtgcttataaatttctctcttttcaacttccgttggaatcttcggtggctgtttcatct |
705000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University