View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16056_low_24 (Length: 434)

Name: NF16056_low_24
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16056_low_24
NF16056_low_24
[»] chr3 (1 HSPs)
chr3 (340-434)||(39541177-39541271)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 340 - 434
Target Start/End: Original strand, 39541177 - 39541271
Alignment:
340 catcccttatctcctaaattcaatctgatgtcccttttcattttcataagccctcaatccaaatcttcatctccccaatgtaactcatgtggtgg 434  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39541177 catcccttatctcctaaattcaatctgatgtcccttttcattttcataagccctcaatccaaatcttcatctccccaatgtaactcatgtggtgg 39541271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University