View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16056_low_43 (Length: 311)
Name: NF16056_low_43
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16056_low_43 |
 |  |
|
| [»] scaffold0314 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0314 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: scaffold0314
Description:
Target: scaffold0314; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 15 - 295
Target Start/End: Complemental strand, 10087 - 9807
Alignment:
| Q |
15 |
attttcttctagtgattgctagtgttcttatttaatagaaggaatgcaaacaacatactattattgtttaaagattatgttacttgcatcttcttattaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10087 |
attttcttctagtgattgctagtgttcttatttaatagaaggaatgcaaacaacatactattattgtttaaagattatgttacttgcatcttcttattaa |
9988 |
T |
 |
| Q |
115 |
aatgctttataagattcatgtcagcattgaaatatgaatgttattggattcgggtactggtggttttttaatagtagatgatgttggacaagnnnnnnng |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9987 |
aatgctttataagattcatgtcagcattgaaatatgaatgttattggattcgggtactggtggttttttaatagtagatgatgttggacaagtttttttg |
9888 |
T |
 |
| Q |
215 |
gaggcctgctcattcattgataaataggtgcataacacctattctaatggctgttctgtgtatgacaaacttgctgttctg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9887 |
gaggcctgctcattcattgataaataggtgcataacacctattctaatggctgttctgtgtatgacaaacttgctgttctg |
9807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University