View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16056_low_46 (Length: 296)
Name: NF16056_low_46
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16056_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 9e-73; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 80 - 226
Target Start/End: Complemental strand, 3703685 - 3703539
Alignment:
| Q |
80 |
gagggaaaaaggaggattgaaatcacatgatttcctaaaagacattcgtaatccgaaggagctagagtttgtgaagccggagcaaagtgacatgagtgtc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3703685 |
gagggaaaaaggaggattgaaatcacatgatttcctaaaagacattcgtaatccgaaggaactagagtttgtgaagccggagcaaagtgacatgagtgtc |
3703586 |
T |
 |
| Q |
180 |
caactaccaagtttgagatgagatcgaagcaaaaaattaataaacaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3703585 |
caactaccaagtttgagatgagatcgaagcaaagaattaataaacaa |
3703539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 3703779 - 3703695
Alignment:
| Q |
13 |
tgaatagtttttggtgtgttttacttagttttgattaaattttagataagagattttatttctcttggagggaaaaaggaggatt |
97 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3703779 |
tgaataatttttggtgtgttttacttagttttgattaaattttagataagagattttatttctcttggagggaaaaaggaggatt |
3703695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 220 - 295
Target Start/End: Complemental strand, 3703511 - 3703422
Alignment:
| Q |
220 |
taaacaagaaccaagttttgcttgtggtagaggaaacc--------------gtaaatagcagaaacagtgcaaatatgagtcaggtaac |
295 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3703511 |
taaataagaaccaagttttgcttgtggtagaggaaaccttaatggttgtggagtaaatagcagaaacagtgcaaatatgagtcaggtaac |
3703422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University