View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16056_low_49 (Length: 269)
Name: NF16056_low_49
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16056_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 100 - 256
Target Start/End: Complemental strand, 1954485 - 1954333
Alignment:
| Q |
100 |
atgacgcacattgcccttaactaattaaagggtccatttcatcacaataactttgataattaagcatcttccactttcacacctttttctttgtttattg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1954485 |
atgacgcacattgcccttaactaattaaagggtccatttcatcacaataactttgataa----gcatcttccactttcacacctttttctttgtttatag |
1954390 |
T |
 |
| Q |
200 |
aaaatggttgatcactttaaaccgttttccatttacgactatactcatgttcatctc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1954389 |
aaaatggttgatcactttaaaccgttttccatttacgactatactcatgttcatctc |
1954333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 1954568 - 1954521
Alignment:
| Q |
17 |
cacttcttttgtttaatttaattgtaagtggttactcccacttgcttt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1954568 |
cacttcttttgtttaatttaattgtaagtggttactcccacttgcttt |
1954521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 1976024 - 1976057
Alignment:
| Q |
20 |
ttcttttgtttaatttaattgtaagtggttactc |
53 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
1976024 |
ttcttttgtttaatttaattataagtggttactc |
1976057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University