View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16056_low_50 (Length: 255)
Name: NF16056_low_50
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16056_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 55719471 - 55719249
Alignment:
| Q |
19 |
ctcttaatttaattctattctatatttcaactcttgttttaaatatgatacatcaatatcatatatgtctatctctcttgctttttcaatgaagcatgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55719471 |
ctcttaatttaattctattctatatttcaactcttgttttaaatatgatacatcaatatcatatatgtctatctctcttactttttcaatgaagcatgat |
55719372 |
T |
|
| Q |
119 |
aaaaacattannnnnnncatgtttaactatccaagtaaacaagcaactcataacacattcacatgaaacaacaattttacaaaggatacaactcatatat |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55719371 |
aaaaacattatttttt-catgtttaactatccaagtaaacaagcaactcataacacattcacatgaaacaacaattttacaaaggatacaactcatatat |
55719273 |
T |
|
| Q |
219 |
aaatttttagacaatttatgtgtt |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
55719272 |
aaatttttagacaatttatgtgtt |
55719249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University