View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16056_low_57 (Length: 238)
Name: NF16056_low_57
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16056_low_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 10 - 221
Target Start/End: Complemental strand, 28268314 - 28268103
Alignment:
| Q |
10 |
ccttctgaggaaaccccatacaacttggttatgtagactttctaatttctattagttcaatgaatgaaaacaatatgaaacaggttcaattatgaatttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28268314 |
ccttctgaggaaaccccatacaacttggttatgtagactttctaatttctattagttcaatgaatgaaaacaatatgaaacaggttcaattatgaatttg |
28268215 |
T |
|
| Q |
110 |
ttaaatttactagcataccaaaaaccttggttgtcagctttactggcctcatttcttctccaaacctgtgtacattcaataagaaatatatttttggata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28268214 |
ttaaatttactagcataccaaaaaccttggttgtcagctttactggcctcatttcttctccaaacctgtgtacattcaataagaaatatatttttggata |
28268115 |
T |
|
| Q |
210 |
ttgacttggagc |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28268114 |
ttgacttggagc |
28268103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University