View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16056_low_58 (Length: 237)
Name: NF16056_low_58
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16056_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 6374582 - 6374380
Alignment:
| Q |
20 |
aaaagtgagaatatttgcctctatcttgtaatttttggtccgtctattttctttttctttatattctttgtggtaaaatatgaaatatataagattgtcc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6374582 |
aaaagtgagaatatttgcctctatcttgtaatttttggtccgtctattttctttttctttatattctttgtggtaaaatatgaaatatataagattgtct |
6374483 |
T |
 |
| Q |
120 |
acaagtccatgctcactcgaaaaaattgccgaaatcactatgcggacatcgtggtcaaggttcaaactatttatgtgtgtgaatttccaattactatttt |
219 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6374482 |
acaagtccgtgctcaatcgaaaaaattgccgaaatcactatgtggacatcgtggtcagggttcaaactatttatgtgtgtgaatttccaattactatttt |
6374383 |
T |
 |
| Q |
220 |
cat |
222 |
Q |
| |
|
||| |
|
|
| T |
6374382 |
cat |
6374380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University