View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16056_low_59 (Length: 236)
Name: NF16056_low_59
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16056_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 27846277 - 27846470
Alignment:
| Q |
18 |
gaagatctattaattcacttgggccataaccaggcctaagcgtaccaaaccatgacaatgataggtacacaagaagaagaatgaaccatgtgcgcaagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27846277 |
gaagatctattaattcacttgggccataaccaggcctaagcgtaccaaaccatgacaatgataggtacacaagaagaagaatgaaccatgtgcgcaagat |
27846376 |
T |
|
| Q |
118 |
agcaaaaatgtagctggtagaaaagttgacaaagtttggtgagatgtcttgtgattaaataatgagaaagattgagataagcacagaaaatcggt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27846377 |
agcaaaaatgtagctggtagaaaagttgacaaagtttggtgagatgtcttgtgattaaataatgag-aagattgagataagcacagaaaatcggt |
27846470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University