View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16056_low_60 (Length: 236)
Name: NF16056_low_60
Description: NF16056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16056_low_60 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 40287309 - 40287461
Alignment:
| Q |
1 |
acttaaaagtaatgaacacaatattaatttaacgataaattaatcagtaaataacacatatcaaaattgtttctaactccaaaacgtgtccatgagatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40287309 |
acttaaaagtaatgaacacaatattaatttaatgataatttaatcagtaaataaca--tatcaaaattgtttctaactccaaaacgtgtccatgagatta |
40287406 |
T |
 |
| Q |
101 |
tgaatattttaaaatgttgtttgattatgtcaaatgttactcacttccacccttc |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40287407 |
tgaatattttaaaatgttgtttgattatgtcaaatgttactcacttccacccttc |
40287461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 149
Target Start/End: Complemental strand, 3914874 - 3914818
Alignment:
| Q |
93 |
tgagattatgaatattttaaaatgttgtttgattatgtcaaatgttactcacttcca |
149 |
Q |
| |
|
||||||||||||||||| ||| || | || |||| |||||||||||||||| ||||| |
|
|
| T |
3914874 |
tgagattatgaatatttcaaattggtcttcgattctgtcaaatgttactcaattcca |
3914818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University