View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16058_high_22 (Length: 316)
Name: NF16058_high_22
Description: NF16058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16058_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 16 - 295
Target Start/End: Complemental strand, 36622235 - 36621956
Alignment:
| Q |
16 |
agcaaagggaagagatagatcatgtgagaaaagctaggcaaatgcaattttggtgggaaagccctgttgatgaacttggcttgaatgaattgctccagtt |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36622235 |
agcaaggggaagagatagatcatgtgagaaaagctaggcaaatgcaattttggtgggaaagccctgttgatgaacttggcttgaatgaattgctccaatt |
36622136 |
T |
 |
| Q |
116 |
aaaggtttctattgaggacctgaggaagaatcttggaaaaattgctagcaaatgcatgatggaacaatccaatgtttcttcatcaaatattggagctaat |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622135 |
aaaggtttctattgaggacctcaggaagaatcttggaaaaattgctagcaaatgcatgatggaacaatccaatgtttcttcatcaaatattggagctaat |
36622036 |
T |
 |
| Q |
216 |
ggatttttaggtgtagggattaatattgcttccccacttcctaatagctattatctaggttttcgaatttgacatctttg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622035 |
ggatttttaggtgtagggattaatattgcttccccacttcctaatagctattatctaggttttcgaatttgacatctttg |
36621956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University