View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16058_high_29 (Length: 240)
Name: NF16058_high_29
Description: NF16058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16058_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 29286178 - 29286386
Alignment:
| Q |
17 |
tgagcaattatttacaattaactctaatgatatcagaaattgtgtgttattggatgacccagaagtagagaaacatgcgacacaaattggaaattagtgc |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29286178 |
tgagcaattgtttacaattaactctaatgatatcagaaattgtgtgttattggatgacccagaagtagagaaacatgcgacacaaattggaaattagtgc |
29286277 |
T |
 |
| Q |
117 |
agccaactaatttccacttgccaatggc-ttgacataacccttgagctagacgtctatacttattctctctacgctgagcaacaatcatatcaacataga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29286278 |
agccaactaatttccacttgccaatggctttgacataacccttgagctagacgtctatacttattctctctacgctgagcaacaatcatatcaacataga |
29286377 |
T |
 |
| Q |
216 |
cggaaaatg |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
29286378 |
cggaaaatg |
29286386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 88 - 222
Target Start/End: Original strand, 35234454 - 35234593
Alignment:
| Q |
88 |
aacatgcgacacaaattggaaattagtgcagccaactaatttccacttgccaatggcttgacataaccctt-----gagctagacgtctatacttattct |
182 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||| |||||| |||| | ||||||| || ||||||||||| |||||||||||| |
|
|
| T |
35234454 |
aacatgctacacaaattggaaattagtgcagccaaccaatttccatttgccagtggcattgcataacctttagtttgagctagacgtatatacttattct |
35234553 |
T |
 |
| Q |
183 |
ctctacgctgagcaacaatcatatcaacatagacggaaaa |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
35234554 |
ctcttcgctgagcaacaatcatatcaacatagatggaaaa |
35234593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 17 - 59
Target Start/End: Original strand, 35234352 - 35234394
Alignment:
| Q |
17 |
tgagcaattatttacaattaactctaatgatatcagaaattgt |
59 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
35234352 |
tgagcaattatttacaataaactctaatgatatcagaatttgt |
35234394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University