View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16058_high_38 (Length: 202)
Name: NF16058_high_38
Description: NF16058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16058_high_38 |
 |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 9e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 13 - 181
Target Start/End: Original strand, 38633134 - 38633302
Alignment:
| Q |
13 |
tagattatactatcttcaaaaggatcggagaaaccgcgtggcgagtaaagagaagatacttatggatttatatatggctcttgatgaattgaatttcatg |
112 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38633134 |
tagattacactatctacaaaaggaacggagaaaccgcgtggcgagtaaggagaagatacttagggatttatatatggctcttgatgagttgaatttcatg |
38633233 |
T |
 |
| Q |
113 |
aacaaagcatcaaagggaggacggtttggggaaaagcctgataaaaatgttagaaaaatacaggtattt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
38633234 |
aacaaagcatcaaagggaggacggtttggggaaaagcctgataaaaatgttagaaaaatatagctattt |
38633302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 76 - 181
Target Start/End: Original strand, 38637182 - 38637287
Alignment:
| Q |
76 |
ggatttatatatggctcttgatgaattgaatttcatgaacaaagcatcaaagggaggacggtttggggaaaagcctgataaaaatgttagaaaaatacag |
175 |
Q |
| |
|
|||||| |||||| |||||||| ||||||||||||| ||||||| | |||| |||| | |||| |||||||||| |||||||||||| ||||||||| || |
|
|
| T |
38637182 |
ggatttgtatatgactcttgatcaattgaatttcataaacaaagtagcaaatggagaatggttcggggaaaagcttgataaaaatgtaagaaaaataaag |
38637281 |
T |
 |
| Q |
176 |
gtattt |
181 |
Q |
| |
|
||||| |
|
|
| T |
38637282 |
ctattt |
38637287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 106
Target Start/End: Original strand, 12138 - 12206
Alignment:
| Q |
38 |
cggagaaaccgcgtggcgagtaaagagaagatacttatggatttatatatggctcttgatgaattgaat |
106 |
Q |
| |
|
||||||||| | ||||||| ||||| ||| ||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
12138 |
cggagaaacagtgtggcgattaaagggaaaatactaagggattttaatatggctcttgatgaattgaat |
12206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University