View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16058_low_16 (Length: 351)
Name: NF16058_low_16
Description: NF16058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16058_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 9 - 333
Target Start/End: Original strand, 33317485 - 33317809
Alignment:
| Q |
9 |
ggtagattattctgtttgttggcattgtttgatggcacctaacctctttgcaaacatggaaaccattgcctctgaatctctcaatctcgaaaaaggtgta |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33317485 |
ggtagactattctgtttgttggcattgtttgatggcacctaacctctttgcaaacatggaaaccattgcctctgaatctctcaatctcgaaaaaggcgta |
33317584 |
T |
 |
| Q |
109 |
acattgttaaacttatgcttagatatgtcctcattgtttcccttctcatctttaagaccaatggaagaagaagcctctttgttgataaaacaattctgta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33317585 |
acattgttaaacttatgcttagatatgtcctcattgtttcccttctcatctttaagaccaatggaagaagaagcctctttgttgataaaacaattctgta |
33317684 |
T |
 |
| Q |
209 |
actttttagtctcaatgaccaattggttatcagcatattgttctttagtctcttcaaccttgcagtcattcaaatgagaaattggtgagtataatgtcat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33317685 |
actttttagtctcaatgaccaattggttatcagcatattgttctttagtctcttcaaccttgcattcattcaaatgagaaattggtgagtataatgtcat |
33317784 |
T |
 |
| Q |
309 |
tccttctttctccttactaatctct |
333 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33317785 |
tccttctttctccttactaatctct |
33317809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 175 - 213
Target Start/End: Complemental strand, 347724 - 347686
Alignment:
| Q |
175 |
gaagaagcctctttgttgataaaacaattctgtaacttt |
213 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
347724 |
gaagaagcctctttgttcataaaacaattatgtaacttt |
347686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University