View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16058_low_26 (Length: 282)

Name: NF16058_low_26
Description: NF16058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16058_low_26
NF16058_low_26
[»] chr1 (1 HSPs)
chr1 (16-103)||(29388895-29388982)


Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 16 - 103
Target Start/End: Complemental strand, 29388982 - 29388895
Alignment:
16 acactctacttagcatctttagtttaaatagataaaatgattttccaaattatgttgcctttaacnnnnnnnttaaccttcactcgat 103  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
29388982 acactatacttagcatctttagtttaaatagataaaatgattttccaaattatgttgcctttaacaaaaaaattaaccttcactcgat 29388895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University