View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16058_low_27 (Length: 250)
Name: NF16058_low_27
Description: NF16058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16058_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 43359589 - 43359351
Alignment:
| Q |
1 |
cttacaatatggggaaccgaggaagtatttaagaccaaaagagcatatatttatcgcaagcaattagtgatattgatcgatagtaattgtgaggattgtt |
100 |
Q |
| |
|
|||||||| | |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43359589 |
cttacaatctcgggaacggagggagtatttaagaccaaaagagcatatatttatcgcaagcaattagtgatattgatcgatagtaattgtgaggattgtt |
43359490 |
T |
 |
| Q |
101 |
ttgaatttggtactgccatttataaattataaatgtaagtaaagtttagcttaccattcaaactagtggtgtgctggattttgttaagataaaagtgaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43359489 |
ttgaatttggtactgccatttataaattataaatgtaagtaaagtttagcttaccattcaaactaatggtgtgctggattttgttaagataaaagtgaat |
43359390 |
T |
 |
| Q |
201 |
atgaccat--acattctaaaacagggggcaacgggattt |
237 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43359389 |
atgaccatacacattctaaaacagggggcaacgggattt |
43359351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University