View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16058_low_28 (Length: 246)
Name: NF16058_low_28
Description: NF16058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16058_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 28 - 177
Target Start/End: Original strand, 43359819 - 43359973
Alignment:
| Q |
28 |
cttataatataggacgaagggaatataataatagataattttgtca------attaaatacatcaatttatgtggaatacattgcctcttatattatatt |
121 |
Q |
| |
|
|||||||||||||||||||| | |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43359819 |
cttataatataggacgaaggaagtatagtaatagataattttgtcagcgtaaattaaatacatcaatttatgtggaatacattgcctcttatattatatt |
43359918 |
T |
 |
| Q |
122 |
aagactggaggttgagagattatgtactgccaaatagttaggacatcttattaatc |
177 |
Q |
| |
|
|||||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43359919 |
aagactagaggttgagaga-tatgtgatgccaaatagttaggacatcttattaatc |
43359973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University