View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16059_high_7 (Length: 242)
Name: NF16059_high_7
Description: NF16059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16059_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 49 - 230
Target Start/End: Complemental strand, 42623280 - 42623099
Alignment:
| Q |
49 |
ctcttattcttggattgtttcaattttgttattaacttttcgattattctgattaggatcctgaattgcctccgattgtggaagaagaaggtgaatccct |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42623280 |
ctcttattcttggattgtttcaattttgttattaacttttcgattattctgattaggatcctgaattgcctccgattgtggaagaagaaggtgaatcctt |
42623181 |
T |
|
| Q |
149 |
accagttcctaacgatgagagggctcttgtactcttcaaacccatgaatcttcattctccttccgatttctctctcactctc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42623180 |
accagttcctaacgatgagagggctcttgtactcttcaaacccatgaatcttcattctccttccgatttctctctcactctc |
42623099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University