View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16059_low_6 (Length: 266)
Name: NF16059_low_6
Description: NF16059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16059_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 27763891 - 27763739
Alignment:
| Q |
1 |
ttttgctttgctctagacgggtaatgcatgaacctattttaaagaccattccttttccacctcaagctccaaattgcaatgatacattttttgtcacatg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27763891 |
ttttgctttgctctagacgggtaacgcacgaacctattttaaagaccattccttttccacctcaagctccaaattgcaatgatacattttttgtcacatg |
27763792 |
T |
 |
| Q |
101 |
atagactgaata--atggcaaagatagcttcattaaacccttccaccatagcc |
151 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27763791 |
atagactgaatagcatggcaaagatagcttcattaaacccttccaccatagcc |
27763739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 183 - 248
Target Start/End: Complemental strand, 27763347 - 27763282
Alignment:
| Q |
183 |
tgaatctaaccaaaccatgcgaatgcaagaatgctaaatctttgatggtgaactttgtcatccatt |
248 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
27763347 |
tgaatctaactaaaccatacgaatgcaagaatgttaaatctttgagagagaactttgtcatccatt |
27763282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University