View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1605_high_18 (Length: 320)
Name: NF1605_high_18
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1605_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 17 - 122
Target Start/End: Complemental strand, 18670927 - 18670822
Alignment:
| Q |
17 |
aaattagattatatctcactaaaaagctatgtgaatatagttgttaggatcacaagttaaataatagcatcaataaatattacgatcttacaatcacttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18670927 |
aaattagattatatctcactaaaaagctatgtgaatatagttgttaagatcacaagttaaatcatagcatcaataaatattacgatcttacatccacttg |
18670828 |
T |
 |
| Q |
117 |
gagata |
122 |
Q |
| |
|
|||||| |
|
|
| T |
18670827 |
gagata |
18670822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 254 - 314
Target Start/End: Complemental strand, 18670801 - 18670741
Alignment:
| Q |
254 |
atttatgtatgatttagtaatcactgttatttatataataacaaatatatagaattattta |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18670801 |
atttatgtatgatttagtaatcactgttatttatataataacaaatatatagaattattta |
18670741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University