View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1605_high_38 (Length: 231)
Name: NF1605_high_38
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1605_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 84
Target Start/End: Complemental strand, 26245870 - 26245803
Alignment:
| Q |
17 |
cataggggctttggaaggaagaagctatcgtgcaagggtttctgcaattcaattataaagattttaac |
84 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26245870 |
cataggggctatggaaggaagaagctatcgtgcaagggtttctgcaattcaattataaagattttaac |
26245803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 149 - 214
Target Start/End: Complemental strand, 26245745 - 26245680
Alignment:
| Q |
149 |
cgcgagtttagaagggattcttctgtgagaagcgatggtgaaggtgggagttgcaggaactgatag |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26245745 |
cgcgagttgagaagggattcttctgtgagaagcgatggtgaaggtgggagttgcaggaactgatag |
26245680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University