View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1605_low_23 (Length: 289)
Name: NF1605_low_23
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1605_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 25 - 273
Target Start/End: Original strand, 30715284 - 30715532
Alignment:
| Q |
25 |
tcatcatagaattccaaaacaaaagttatcagaagaatacaaagacgaggacaacgataataatagtactgatgcaaacgatgtggattctaaatctcaa |
124 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
30715284 |
tcataatagaattccaaaacaaaagttatcagaagaatacaaagacgaggacaacgataataatagtactgatgcagacgatgtggattctgaatctcaa |
30715383 |
T |
|
| Q |
125 |
gaggatcaacaccgacaatttgaagatgaaaccgaaaaagaggaagaagacaatgatgacgatgacgatgatgtttctgaatccttgtccaatgcaccac |
224 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715384 |
gaggatcaacaccgacagtttgaagatgaaaccgaagaagaggaagaagacaatgatgacgatgacgatgatgtttctgaatccttgtccaatgcaccac |
30715483 |
T |
|
| Q |
225 |
atggtaaaccatctttctcacaagaagcacacattggcaatgttccaga |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715484 |
atggtaaaccatctttctcacaagaagcacacattggcaatgttccaga |
30715532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University