View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1605_low_31 (Length: 249)
Name: NF1605_low_31
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1605_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 56 - 161
Target Start/End: Complemental strand, 18670689 - 18670584
Alignment:
| Q |
56 |
cttgaggattcaatcaagctttattataatataaaagaaactattctttgcaaatggcatgtaaaggaaagaaaaatagattatattctcctatgtaatg |
155 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18670689 |
cttgaggattcaatcaaactttattatcatataaaataaactattctttgcaaatggcatgtaaaggaaagaaaaatagattatattctcctatgtaatg |
18670590 |
T |
|
| Q |
156 |
aaaaaa |
161 |
Q |
| |
|
|||||| |
|
|
| T |
18670589 |
aaaaaa |
18670584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 155 - 238
Target Start/End: Complemental strand, 18670561 - 18670479
Alignment:
| Q |
155 |
gaaaaaatataaacaagtaatgaaagataccgccaaacccaacacttatgacatgtttgttatatcataaattctcttattcat |
238 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18670561 |
gaaaaaatataa-caggtaatgaaagataccgccaaacacaacacttatgacatgtttgttatatcataaattctcttattcat |
18670479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University