View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1605_low_34 (Length: 241)
Name: NF1605_low_34
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1605_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 25575589 - 25575378
Alignment:
| Q |
18 |
agaaccccatccagactcaatgtcatcttcaactctgcgctttttgtctattttatcagcatgctcatcatccaatctgttatattttctccgcaacgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25575589 |
agaaccccatccagactcaatgtcatcttcaactctgcgctttttgtctattttatcagcatgctcatcatccaatctgttatattttctccgcaacgag |
25575490 |
T |
 |
| Q |
118 |
tgttctttcctacaattttgcatcttatgacctgcttctccacgtctataaccagtatgctttaattttgaactgtttgggcgattcaaggtttcctcac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25575489 |
tgttctttcctacaattttgcatcttatgacctgcttctccacgtctataaccagtatgctttaattttgaactgtttgggcggttcaaggtttcctcac |
25575390 |
T |
 |
| Q |
218 |
caatctgtgctc |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25575389 |
caatctgtgctc |
25575378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University