View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1605_low_35 (Length: 241)
Name: NF1605_low_35
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1605_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 215
Target Start/End: Complemental strand, 4783354 - 4783149
Alignment:
| Q |
10 |
gcatagggcacagctaattaactaacttaaactaattgatatatacacctaagcttgaattattaatctcaacatgctttcttaatttaaactttcaaaa |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4783354 |
gcatagggcacagctaactaactaacttaaactaattgttatatgcacctaagcttgaattattaatctcaacatgctttcttaatttaaactttcaaaa |
4783255 |
T |
|
| Q |
110 |
gctacaacacctagctttcttctcagttttaaaatatggacctttttgatagacttggtgaatatatcagttgtttgatcattggacaattttcaacaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4783254 |
gctacaacacctagctttcttctcagttttaaaatatggacctttttgatagacttggtgaatatatcagttgtttgatcattggacaattttcaacaat |
4783155 |
T |
|
| Q |
210 |
tatcgt |
215 |
Q |
| |
|
|||||| |
|
|
| T |
4783154 |
tatcgt |
4783149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University