View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1605_low_41 (Length: 231)

Name: NF1605_low_41
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1605_low_41
NF1605_low_41
[»] chr4 (2 HSPs)
chr4 (17-84)||(26245803-26245870)
chr4 (149-214)||(26245680-26245745)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 84
Target Start/End: Complemental strand, 26245870 - 26245803
Alignment:
17 cataggggctttggaaggaagaagctatcgtgcaagggtttctgcaattcaattataaagattttaac 84  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26245870 cataggggctatggaaggaagaagctatcgtgcaagggtttctgcaattcaattataaagattttaac 26245803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 149 - 214
Target Start/End: Complemental strand, 26245745 - 26245680
Alignment:
149 cgcgagtttagaagggattcttctgtgagaagcgatggtgaaggtgggagttgcaggaactgatag 214  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26245745 cgcgagttgagaagggattcttctgtgagaagcgatggtgaaggtgggagttgcaggaactgatag 26245680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University