View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1605_low_43 (Length: 226)
Name: NF1605_low_43
Description: NF1605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1605_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 21 - 184
Target Start/End: Complemental strand, 42297384 - 42297222
Alignment:
| Q |
21 |
gataaaatatttcttgatatatatagtattgctctattaaaatagacagaaacatattggagattaaaatctggttgataacttaacgtgtagattttaa |
120 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42297384 |
gataaaatctttcttgatatata--gcattgctctattaaaatagacagaaacatattggagattaaaatctggttgataacttaacgtgtagattttaa |
42297287 |
T |
 |
| Q |
121 |
aataaattgaagaggccgtacc-tttaagtaagttggttagcttcaaattctgaatcatgtgaat |
184 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42297286 |
aataaattgaagaggtcgtaccttttaagtaagttggttagcttcaaattctgaatcatgtgaat |
42297222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University