View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16060_high_16 (Length: 235)
Name: NF16060_high_16
Description: NF16060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16060_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 6 - 157
Target Start/End: Original strand, 20117969 - 20118121
Alignment:
| Q |
6 |
ttttgttttaaaatatatttgtttttataccacatatatgcataaaa-ataccatatatgcgtgtgtcacttacagttgtaaagaattttcatccaccat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20117969 |
ttttgttttaaaatatatttgtttttataccacatatatgcataaaaaataccatatatgcgtgtgtcacttacagttgtaaagaattttcatccaccat |
20118068 |
T |
|
| Q |
105 |
gatagctgatttttactactctcgaaagctgatgtcctagtagcaagaatttc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20118069 |
gatagctgatttttactactctcgaaagctgatgtcctagtagcaagaatttc |
20118121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 19 - 157
Target Start/End: Original strand, 20088804 - 20088950
Alignment:
| Q |
19 |
tatatttgtttttataccacatatatgcataaaaa-taccatatatgcgtgt----gtcacttacag---ttgtaaagaattttcatccaccatgatagc |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| |||||| |||| ||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20088804 |
tatattggtttttataccatatatatgcataaaaaatactatatatatgtgtttgtgtcacttacagcagttgtaaagaattttcctccaccatgatagc |
20088903 |
T |
|
| Q |
111 |
tgatttttactactctcgaaagctgatgtcctagtagcaagaatttc |
157 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20088904 |
tgatttttactactctcaaaagctgatgtcctagtagcaagaatttc |
20088950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University