View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16060_low_14 (Length: 263)
Name: NF16060_low_14
Description: NF16060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16060_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 104 - 248
Target Start/End: Original strand, 3635338 - 3635482
Alignment:
| Q |
104 |
gttgcagaatgtgggaattctctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggtgctgttgaatctgcttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3635338 |
gttgcagaatgtgggaattctctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggggctgttgaatctgcttc |
3635437 |
T |
 |
| Q |
204 |
cattgcattgtttggtcctttgattggaacatgggttgataagtt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3635438 |
cattgcattgtttggtcctttgattggaacatgggttgataagtt |
3635482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 105 - 248
Target Start/End: Original strand, 3644771 - 3644914
Alignment:
| Q |
105 |
ttgcagaatgtgggaattctctgttggtttatatatgatcagtatttggccagactcactgttgtatgcagcaatatatggtgctgttgaatctgcttcc |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3644771 |
ttgcagaatgtgggaattttctgttggtttatatatgatcagtatttggccagactcactgctctatgcagcaatatatggtgctgttgaatctgcttcc |
3644870 |
T |
 |
| Q |
205 |
attgcattgtttggtcctttgattggaacatgggttgataagtt |
248 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
3644871 |
attgcattgtttggtcccataattggaacatgggttgataagtt |
3644914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University