View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16060_low_17 (Length: 232)
Name: NF16060_low_17
Description: NF16060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16060_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 34882065 - 34881863
Alignment:
| Q |
17 |
agcagttgggtaagaaatttagtattgttactcgttttcttttctctaccttagcaatacacatattgtcataactcataaatcttcactttgcattagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34882065 |
agcagttgggtaagaaatttagtattgttactcgttttcttttctctaccttagca-tacacatattgtcataactcataaatcttcactttgcattagg |
34881967 |
T |
|
| Q |
117 |
tcagccattttccacccggatacaagcaagaacgagttgtaggattaggcctgaatgaagaagaattgaagagaaacccggtaagacaaccctctttctg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34881966 |
tcagccattttccacccggatacaagcaagaacgagttgtaggattaggcctgaatgaagaagaattgaagagaaacccggttagacaaccctctttctg |
34881867 |
T |
|
| Q |
217 |
tgct |
220 |
Q |
| |
|
|||| |
|
|
| T |
34881866 |
tgct |
34881863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University