View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16061_low_3 (Length: 257)
Name: NF16061_low_3
Description: NF16061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16061_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 49034996 - 49035222
Alignment:
| Q |
13 |
atattcaactccttgttataactaactaaaacgtgtgagtgcattaaaatttaaaaggcttgtattgtagttttgttataacaagttttagcattgcttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49034996 |
atattcaactccttgttataactaactaaaacgtgtgagtgcattaaaatttaaaaggcttgtattgtagttttgttataacaagttttagcattgcttt |
49035095 |
T |
 |
| Q |
113 |
tcgaaataaaaagaaagaacactcatgtagagcgagcataagataaaaatgatcctttttgtatgctataagtttggtgtgttttagttttttgcttcag |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49035096 |
tcgaaataaaaagaaaaaacactcatgtagagcgagcataagataaaaatgatcctttttgtatgctataagtttggtgtgttttagttttttgcttcag |
49035195 |
T |
 |
| Q |
213 |
atgaaaggctaaaggctgtgagaagga |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49035196 |
atgaaaggctaaaggctgtgagaagga |
49035222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University