View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16062_low_6 (Length: 307)
Name: NF16062_low_6
Description: NF16062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16062_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 23 - 291
Target Start/End: Complemental strand, 45112720 - 45112450
Alignment:
| Q |
23 |
ttaatgcaaggggataaaaattgagtctaaataatttgttgagttt--taccttctttgagcgaggaattatagctgaaagctctgtgaatttatgtgct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45112720 |
ttaatgcaaggggataaaaattgagtctaaataatttgttgagtttattaccttctttgagcgaggaattatagctgaaagctctgtgaatttatgtgct |
45112621 |
T |
|
| Q |
121 |
agttcaagtctccttctcctctctgccagtgtgtgaaatagagtcttagatttgcttctaataatcttctcttctttggctaatcctgtgccatttgctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45112620 |
agttcaagtctccttctcctctctgccagtgtgtgaaatagagtcttagatttgcttctaataatcttctcttctttggctaatcctgtgccatttgctt |
45112521 |
T |
|
| Q |
221 |
ttgattcaaagtttagatttgaggaagtcccctttttagggtaacaaggtggtttggacttccctagtatt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45112520 |
ttgattcaaagtttagatttgaggaagtcctctttttagggtaacaaggtggtttggacttccctagtatt |
45112450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 68 - 144
Target Start/End: Complemental strand, 45123090 - 45123014
Alignment:
| Q |
68 |
ttaccttctttgagcgaggaattatagctgaaagctctgtgaatttatgtgctagttcaagtctccttctcctctct |
144 |
Q |
| |
|
||||||| |||||||||||||| |||| ||||||| | |||| || ||||| ||||||||||| ||| |||||||| |
|
|
| T |
45123090 |
ttaccttatttgagcgaggaatgatagtggaaagctgtatgaacttgtgtgcaagttcaagtcttcttttcctctct |
45123014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University