View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16062_low_9 (Length: 236)

Name: NF16062_low_9
Description: NF16062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16062_low_9
NF16062_low_9
[»] chr3 (1 HSPs)
chr3 (15-221)||(16895458-16895664)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 16895458 - 16895664
Alignment:
15 cacataaaggagcgtgccaccacgtctccttaagtgctgaatcctataaatagctgccctaaatgcctttgagttcagcgttttgccgtcgccgacgcca 114  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| ||||| ||     
16895458 cacataaaggagcgtgccaccacgtcttcttaagtgctgaatcctataaatagctgctctgaatgcctttgagttcagggttttgccgtctccgacaccg 16895557  T
115 ccaaaatcggttatggaaatcgtgtcggcgcggtgtcggaacggcactatgccagaacatgttgtggaatatgaggcagagatagaagagaaatgggaga 214  Q
    || ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16895558 ccgaaatcagttatggaaatcgtgtcggcacggtgtcggaacggcactatgccagaacatgttgtggaatatgaggcagagatagaagagaaatgggaga 16895657  T
215 agaaaat 221  Q
    |||||||    
16895658 agaaaat 16895664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University