View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16062_low_9 (Length: 236)
Name: NF16062_low_9
Description: NF16062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16062_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 16895458 - 16895664
Alignment:
| Q |
15 |
cacataaaggagcgtgccaccacgtctccttaagtgctgaatcctataaatagctgccctaaatgcctttgagttcagcgttttgccgtcgccgacgcca |
114 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||| ||||| || |
|
|
| T |
16895458 |
cacataaaggagcgtgccaccacgtcttcttaagtgctgaatcctataaatagctgctctgaatgcctttgagttcagggttttgccgtctccgacaccg |
16895557 |
T |
 |
| Q |
115 |
ccaaaatcggttatggaaatcgtgtcggcgcggtgtcggaacggcactatgccagaacatgttgtggaatatgaggcagagatagaagagaaatgggaga |
214 |
Q |
| |
|
|| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16895558 |
ccgaaatcagttatggaaatcgtgtcggcacggtgtcggaacggcactatgccagaacatgttgtggaatatgaggcagagatagaagagaaatgggaga |
16895657 |
T |
 |
| Q |
215 |
agaaaat |
221 |
Q |
| |
|
||||||| |
|
|
| T |
16895658 |
agaaaat |
16895664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University