View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16064_high_10 (Length: 355)
Name: NF16064_high_10
Description: NF16064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16064_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 1241098 - 1240761
Alignment:
| Q |
1 |
ataattcatcttccaaaagagtatctttctctgaccaacagcaacagcaccaacacaatgttcctttgttacttcaaccatcttatgcaagatcaaaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1241098 |
ataattcatcttccaaaagagtatctttctctgaccaacagcaacagcaccaacacaatgttcctttgttacttcagccatcttatgcaagatcaaaatc |
1240999 |
T |
|
| Q |
101 |
catgatctttgatgaactaagaaactttcggatatgtcttaaatggtgtgctcttgatcactcatcttgtgttggaaaactcatttcttatgtttccttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240998 |
catgatctttgatgaactaagaaactttcggatatgtcttaaatggtgtgctcttgatcactcatcttgtgttggaaaactcatttcttatgtttccttc |
1240899 |
T |
|
| Q |
201 |
atcttccttactttcattgttcctctcttcacaaccctatttgttcaagtatctgcttcttctcctgaagttgatcctatctccttgaacaagcttgttc |
300 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240898 |
atcttccttactttcgttgttcctctcttcacaaccctatttgttcaagtatctgcttcttctcctgaagttgatcctatctccttgaacaagcttgttc |
1240799 |
T |
|
| Q |
301 |
aaatacctgaatctgcacttgccatcatttccttcttc |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240798 |
aaatacctgaatctgcacttgccatcatttccttcttc |
1240761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University