View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16064_high_11 (Length: 353)
Name: NF16064_high_11
Description: NF16064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16064_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 16 - 336
Target Start/End: Original strand, 34644460 - 34644780
Alignment:
| Q |
16 |
aatatccaaacaacttggcaacatggttaacccaaatttgtggcataagaactcacgtttggctttacagaagctgaaccagtcgcacacagtgagacta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34644460 |
aatatccaaacaacttggcaacatggttagcccaaatttgtggcataagaactcacgtttggctttacagaagctgaaccagtcgcacatagtgagacta |
34644559 |
T |
 |
| Q |
116 |
gttcagtacaacgttgtaggtctaaggccacacctattattttatggcatatgtaatcaaataaatccgactcaacgagataatgatttagatttttgga |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34644560 |
gttcagtacaacattgtaggtctaaggccacacctattattttatggcatatgtaatcaaataaatccgactcaacgagataatgatttatatttttgga |
34644659 |
T |
 |
| Q |
216 |
ggatttgaagtagattgtagaagcaacttaccctcgtcattttaatatttcagttttaggaatatgttcaagggagaaatatgtgatttcattcttgctt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34644660 |
ggatttgaagtagattgtagaagcaacttaccctcgtcattttaatatttcagttttaggaatatgttcaagggagaaatatgtgatttcattcttgctt |
34644759 |
T |
 |
| Q |
316 |
caactagcagaagaacacctt |
336 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34644760 |
caactagcagaagaacacctt |
34644780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University