View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16064_high_6 (Length: 424)
Name: NF16064_high_6
Description: NF16064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16064_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 17 - 407
Target Start/End: Complemental strand, 16427100 - 16426710
Alignment:
| Q |
17 |
aattctcaaactcatcttccataacaccttcaacatcccacaaaacaccgtccattttcacaaacgaatcatcaatcgttacactgttcctccacggcgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16427100 |
aattctcaaactcatcttccataacaccttcaacatcccacaaaacaccgtccattttcacaaacgaatcatcaatcgttacactgttcctccacggcgg |
16427001 |
T |
|
| Q |
117 |
attactaccgtttcccttcaaaaacctcccacaacaactcctcagctttacctgaaacccgtcacgtattggttgccattcgtttttaccatctacaccg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16427000 |
attactaccgtttcccttcaaaaacctcccacaacaactcctcagctttacctgaaacccgtcacgtattggttgccattcgtttttaccatctacaccg |
16426901 |
T |
|
| Q |
217 |
ttttctaactccgttaatattaccctttttcctgttagggttaagggatacggtgtttctgttgccgttaaatattttccattgtggctcttcaacctta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16426900 |
ttttctaactccgttaatattaccctttttcctgttagggttaagggatacggtgtttctgttgacgttaaatattttccgttgtggctcttcaacctta |
16426801 |
T |
|
| Q |
317 |
ttacgtggtgatgagtttgtagtttttgaattatctccactgtccattgagctcttttaatggctccgtttcggctttgacggacttttcc |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16426800 |
ttacgtggtgatgagtttgtagtttttgaattatctccactgtccattgagctcttttaatggctccgtttcggctttgacggacttttcc |
16426710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University